 |
|
|
||||
|
|
|
|
||
|
AGR 3303 (3 credits) University of Florida - Fort Lauderdale  |
|
||||||||
|
||||||||
|
||||||||
| Below is Final Exam Part I for 1993, Molecular
genetics |
||||||||
|
||||||||
|
AGR 3303 - Genetics 13 Dec1993 University of Florida - Fort Lauderdale Final Exam PART I (MOLECULAR) Multiple choice. Read these carefully. One and only one response (a, b, c, d, or e) most completely and correctly answers the question, or completes the statement. Circle the appropriate response on the separate grading sheet. (38 pts) PLEASE USE SEPARATE GRADING SHEET 1 Which statement is most true? a The phenotype is determined by the genotype interacting with the environment. b The genotype is determined by the environment interacting with the phenotype. c The phenotype determines the genotype. d The genotype determines the phenotype. e The environment is determined by the genotype interacting with the phenotype. 2 Alien beings are discovered on a galaxy, far, far away. Their genetic material is double-stranded DNA, with the same nitrogenous bases (A, T, G, and C) as earth-based DNA. The aliens' genetic code is based on a linear sequence of codons, with no overlap. However, in contrast to earth-based molecular biology, the code is based on a doublet (two nitrogenous bases) instead of triplet. Therefore: a aliens probably have a different kind of tRNA b aliens must have fewer amino acids than earthlings c aliens have 16 possible codons d all of the above e none of these interpretations fit the evidence 3. Sickle-cell anemia is caused by: a a nonsense mutation b a violation of collinearity c a defective hemoglobin d a defective enzyme e all of the above 4. The Watson-Crick model of DNA structure was: a based on X-ray crystallography b predicted from triplet binding c the Central Dogma of molecular biology d the first direct proof that DNA is the molecule of life e all of the above 5. The normal human metabolic pathway makes substance Z from substance X, as shown below. If Enzyme B were defective, what would be the most probable consequence? Enzyme A Enzyme B X > Y > Z a Substance Y would accumulate in the body b Substance X would accumulate in the body c Enzyme B would accumulate in the body d Enzyme A would not be produced e Enzyme B would go ahead and complete the synthesis of Z 6. Human insulin can be produced by bacteria, using human DNA. This proves that: a bacteria and humans must have similar coding dictionaries b the genetic material is DNA c genetics can help people d all of the above e none of the above 7. The bacteria of Avery et al. (1944) were transformed by a substance which remained active: a after spontaneous creation b when radioactive 32P was detected c after treatment by RNase d after treatment by DNase e all of the above 8. Translation: a occurs in the ribosomes b is the process which produces a polypeptide d occurs after transcription d is involved with the coding dictionary e all of the above 9. The human genetic disease phenylketonuria (PKU) results in mental retardation. The developing fetus is somehow protected by the mother's placenta. PKU is thus an example of: a a dominant trait b a frameshift mutation c a proto-oncogene mutating to an oncogene d the phenotype is affected by the environment e all of the above 10. Copying of DNA is: a 3' to 5' b conservative c high fidelity d all of the above e none of the above 11. Enzymes: a are proteins b speed up chemical reactions c reduce the energy of activation d are made of polypeptides e all of the above 12. What molecule is transcribed from the DNA template, is single stranded, is typically a large molecule, and has a short half-life (high turnover)? a mRNA b enzyme c polypeptide d rRNA e reverse transcriptase 13. What has molecular biology added to the knowledge of genetics a proof that genes are located in the chromosomes b proof that both the female and the male parent contribute to the characteristics of the offspring c proof that genes act as particles d proof that genes are made of chemicals e proof of the inheritance of acquired characteristics 14. Which is not a characteristic known of the genetic material? a new traits occur spontaneously b offspring resemble the parents c if the parent exercises a muscle it strengthens the muscle in the offspring d variations in the nucleotides specify different forms of an enzyme e absorption of UV 15. A gene can be defined as: a the product of transcription b the product of translation c an chemical factor of inheritance d a polypeptide e none of the above 16. Polynucleotides: a are polymers b contain P, not S c are present in the nucleus d are present in the mitochondria e all of the above 17. Based on the Watson-Crick model of the double helix: a if you know the content of one nitrogenous base (e.g, A) then you know the content of the other three (e.g., T, G, and C) b nitrogenous bases of antiparallel strands are paired by hydrogen bonds c the structure explains the function d for every purine there must be a pyrimidine e all of the above 18. Who first proved that DNA is the genetic material? a Hershey and Chase b Avery, MacLeod, and McCarty c Mendel d Watson and Crick e McClintock 19. A cell-free protein-synthesizing system is used to link amino acids in a polypeptide chain. All necessary enzymes and other chemicals are included. A heteropolymer mRNA template is used, consisting of only three kinds of nucleotides (e.g., A, G and U), in long random sequences (e.g., AAAGUAGUAUAAUUGAUGGAUGGUAGGAAGUA . . . . . . , etc.). Without knowing the coding dictionary, what is the maximum number of different kinds of amino acids which could be linked? a 3 b 4 c 9 d 16 e 27 Short answer. (12 pts) 20. What evidence points to DNA as the hereditary material? Mention one experiment or observation and explain how the evidence shows that DNA is the genetic material. 21. Explain how some alleles can be dominant, and others recessive, based on your knowledge of protein structure and function.
PLEASE USE SEPARATE GRADING SHEET |
|
|||
| (return to top) | |||