Genetics at the University of Florida

 AGR 3303 (3 credits)
University of Florida - Fort Lauderdale

comments to:  turf@ufl.edu
Syllabus Guide Exams More classes Turfgrass Science Genetics Web
Below is exam #1 for 1993, Part B, Molecular genetics
Return to exams main page
Return to Genetics Home Page

AGR 3303 - Genetics 11 Oct 1993

University of Florida - Fort Lauderdale

Exam #1 B: MOLECULAR GENETICS

Name ________________________________________

BONUS QUESTIONS (20 pts.)

 

Read these carefully. One and only one response (a, b, c, d, or e) most completely and correctly answers the question, or completes the statement. Circle the appropriate response and turn in this exam. Please make sure your circle is unambiguous.

 

1. What is the relationship between an enzyme, a polypeptide, and a protein?

a all proteins are enzymes and all proteins are polypeptides

b all enzymes are proteins and all proteins are polypeptides

c all polypeptides are proteins and all polypeptides are enzymes

d all enzymes are polypeptides and all polypeptides are proteins

e all proteins are enzymes and all polypeptides are proteins

2. A particular enzyme ("Vampirase") is an oligomer of two polypeptides, each a product of the same gene ("Vampireaway"). There is both a normal form of the gene and an abnormal form. The abnormal form of the gene produces an abnormal polypeptide, which completely disables the function of the resulting enzyme. Why would heterozygotes (individuals with a normal copy and an abormal copy of the gene) have a slight amount of functional Vampirase?

a because normal polypeptides would join together 25% of the time

b because of the limited correction due to frameshift mutations

c because of the use of an alternative metabolic pathway

d because of diffusible substances

e none of the above

3. Degeneracy means:

a one codon denotes two or more different amino acids

b one amino acid is denoted by two or more different codons

c the same as ambiguity

d the same as nonsense

e the opposite of wobble

4. Pretend that the genetic code is based on doublet, not triplet, codons. A cell-free protein-synthesizing system is used to link amino acids in a polypeptide chain. All necessary enzymes and other chemicals are included. A heteropolymer mRNA template is used, consisting of four kinds of nucleotides (e.g., A, C, G and U), in long random sequences (e.g., ACGGAUCCAUGGUCAUCCGG . . . . . . , etc.). Without knowing the coding dictionary, what is the maximum number of different kinds of amino acids which could be linked?

a 3

b 4

c 16

d 20

e 64

5. A gene can be defined as:

a an enzyme

b a characteristic of an organism

c messenger RNA

d a unit of inheritance

e all of the above

(return to top)

comments to:  turf@ufl.edu